biogem

Roche Light Cycler 480

Services

Running an Roche Light Cycler 480 Experiment at BIOGEM

Decide which assay best suits your needs. We currently support both the sybergreen and UPL approaches, although the UPL is in our opinion a better assay. For more details on the different assays please check out the LC480 resources or contact Glenn Sawyer.

If you are running a UPL assay, please design your assay on line at www.universalprobelibrary.com
An example for gapdh is given below

ProbeFinder has designed the optimal real-time PCR assay for:
AF261085.1 Homo sapiens glyceraldehyde-3-phosphate dehydrogenase (GADPH) mRNA,complete cds.

Input sequence:
atcttcttttgcgtcgccagccgagccacatcgctgagacaccatggggaaggtgaaggt
cggagtcaacggatttggtcgtattgggcgcctggtcaccagggctgcttttaactctgg
taaagtggatattgttgccatcaatgaccccttcattgacctcaactacatggtttacat
gttccaatatgattccacccatggcaaattccatggcaccgtcaaggctgagaacgggaa
gcttgtcatcaatggaaatcccatcaccatcttccaggagcgagatccctccaaaatcaa
gtggggcgatgctggcgctgagtacgtcgtggagtccactggcgtcttcaccaccatgga
gaaggctggggctcatttgcaggggggagccaaaagggtcatcatctctgccccctctgc
tgatgcccccatgttcgtcatgggtgtgaaccatgagaagtatgacaacagcctcaagat
catcagcaatgcctcctgcaccaccaactgcttagcacccctggccaaggtcatccatga
caactttggtatcgtggaaggactcatgaccacagtccatgccatcactgccacccagaa
gactgtggatggcccctccgggaaactgtggcgtgatggccgcggggctctccagaacat
catccctgcctctactggcgctgccaaggctgtgggcaaggtcatccctgagctgaacgg
gaagctcactggcatggccttccgtgtccccactgccaacgtgtcagtggtggacctgac
ctgccgtctagaaaaacctgccaaatatgatgacatcaagaaggtggtgaagcaggcgtc
ggagggccccctcaagggcatcctgggctacactgagcaccaggtggtctcctctgactt
caacagcgacacccactcctccacctttgacgctggggctggcattgccctcaacgacca
ctttgtcaagctcatttcctggtatgacaacgaatttggctacagcaacagggtggtgga
cctcatggcccacatggcctccaaggagtaagacccctggaccaccagccccagcaagag
cacaagaggaagagagagaccctcactgctggggagtccctgccacactcagtcccccac
cacactgaatctcccctcctcacagttgccatgtagaccccttgaagaggggaggggcct
agggagccgcaccttgtcatgtaccatcaataaagtaccctgtgctcaacc


Assay details
Assay rank 1
Universal ProbeLibrary probe #60 (left 
The search was for intron spanning assays.
Length of intron(s) spanned by this assay: 1631 nt

Amplicon 66 nt:
agccacatcgctgagacaccatggggaaggtgaaggtcggagtcaacggatttggtcgtattgggc

This assay has: All criteria met.

You will need to order the external oligonucleotides (left and right) for your gene/assay of interest. Please order these primers from your vendor of choice and submit the dessicated oligonucleotides along with the RNA samples.
You will also need to order the external oligonucleotides (left and right) for a housekeeping gene appropriate to your assay.
You will need to provide us with the Universal ProbeLibrary probe reference for both your gene of interest and the housekeeping gene.
Researchers desiring help with assay design on a fee for services basis can obtain further support (biogem@ucsd.edu) or contact Glenn Sawyer.
RNA must be resuspended with RNAse-free water (NOT DEPC WATER) at a concentration within the range of 0.1 to 1 mg/ml, concentrations outside this range will incur an extra charge if we have to concentrate or dilute the material. Please let us know in advance if the RNA is not at 0.1-1 mg/ml.
Sample submission can be done once the online form has been filled out. Please co-ordinate with James Sprague for RNA sample and oligonucleotide drop off. All RNA samples for target labeling or labeled cRNA targets must be submitted on dry ice.
RNA will be subjected to a QC step in the Bioanalyzer will be used to assess the quality of the RNA. Total RNA provided by the investigator will be assessed for its suitability for LC 480 assays. There is a $10 charge per total RNA sample.
If the RNA does not meet the BIOGEM quality standards the the experiment will be stopped and the user will be notified.
Once the real time PCR experiment is complete, the data analysis files will be deposited on the BIOGEM SUN server. A user account will be created for the researchers to allow access to their data. This data will be only be accessible by the researcher and will not be visible to other researchers. BIOGEM will generate a Project Report, which will include a summary of the particular experiment, RNA quality data, and the raw QPCR data. All data files are backed-up from the server to an off site location routinely.
Researchers desiring help with data analysis on a fee for services basis can obtain further support (biogem@ucsd.edu) or contact Glenn Sawyer.

Please note the following BIOGEM Policy for failed experiments:

The Investigator agrees that they solely are responsible for the quality of the RNA submitted. They are required to provide BIOGEM with the concentration of the sample and the OD260/280 ratio as outlined exactly in the online form. Dilute RNA samples will incur an extra charge. All samples will be delivered to the facility on dry ice only after coordinating a suitable drop off time with James Sprague .

To reduce the rate of failed experiments the assays will not be carried out until the RNA integrity has been established. BIOGEM is not responsible for replacing reagents when the Quality Controls assays are valid.

Last Updated March 2009
By Dr. Gary Hardiman